Κυριακή, 26 Μαΐου 2013

Ανοιχτή επιστολή προς την Κεντρική Επιτροπή Εξετάσεων για το σημαντικό λάθος στη διατύπωση του τέταρτου θέματος της Βιολογίας Κατεύθυνσης

ΑΝΟΙΧΤΗ ΕΠΙΤΟΛΗ ΠΡΟΣ ΤΗΝ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ
Θέμα: Για το σημαντικό λάθος στη διατύπωση του τέταρτου θέματος της Βιολογίας Θετικής Κατεύθυνσης- Μια μέση λύση είναι μια άδικη λύση.

Υπάρχει σημαντικό λάθος στη διατύπωση του τέταρτου θέματος, το οποίο μπορεί να οδηγήσει σε σημαντικές αδικίες στη βαθμολόγησή του.

Πιο συγκεκριμένα: Στο ερώτημα Δ1 ζητείται να γραφούν δύο μόρια που θα προκύψουν μετά την υβριδοποίηση, χωρίς κανένα περιορισμό.

Άρα κάλλιστα ένας υποψήφιος μπορεί να επιλέξει τα κάτωθι δύο μόρια, με δεδομένο ότι το βιβλίο δεν αναφέρει πουθενά ότι η υβριδοποίηση γίνεται όπου υπάρχουν οι περισσότερες συμπληρωματικές βάσεις:

Υβριδοποιημένο μόριο 1

ΣΥΝΔΕΣΗ 1

4. 5’AATTCGGGGGGC3’

2. 3’GCCCCCCGTTAA5’ 

Είτε ΣΥΝΔΕΣΗ 2


5’ – AATTGCCCCCCG – 3’ 

2. 3’ - CGGGGGGCTTAA – 5’ 

Και Υβριδοποιημένο μόριο 2

1. 5’AAATGAAACCAGGATAAG3’ 

3. 3’TTTACTTTGGTCCTATTCTTAA5’.

Ζητείται τα δυο συγκεκριμένα μόρια να ονομαστούν υβριδοποιημένο μόριο 1 και υβριδοποιημένο μόριο 2.)

Στο Δ4 στη συνέχεια ζητείται στα δύο συγκεκριμένα μόρια να προστεθεί DNA δεσμάση και ενδονουκλεάση EcoRI. 

Αν ο μαθητής για το υβριδοποιημένο μόριο 1 έχει χρησιμοποιήσει τη Σύνδεση 1 η DNA δεσμάση, δεν αντιδρά με αυτά. Ομοίως, δεν αντιδρά και η ενδονουκλεάση EcoRI.

Σύμφωνα με κάποιες πληροφορίες, που δεν μπορεί να είναι έγκυρες αφού η ΚΕΕ δεν βγάζει επίσημα ανακοίνωση, αναγνωρίστηκε το ενδεχόμενο, σύμφωνα με τις γνώσεις του σχολικού βιβλίου (αλλιώς δεν υπάρχει ούτε καν η θεωρητική βάση των ίσων ευκαιριών που πρέπει να δίνει ένα δημόσιο σχολείο), στο Δ1 ένας μαθητής να επιλέξει ένα ζεύγος υβριδοποιημένων μορίων που δεν είναι δυνατόν να ικανοποιήσουν αυτά που ζητούνται στο Δ4. Ακόμη, «ακούγεται» ότι η κατεύθυνση είναι να εξεταστεί το Δ4 με βάση τη γενικότερη αιτιολόγησή του κλπ.

Είναι εξαιρετικά άδικο:

- Η διατύπωση στο Δ4, δεν ζητάει να εξεταστεί αν γίνονται αυτά που ζητούνται και στη συνέχεια να αιτιολογηθούν οι αποφάσεις του μαθητή. Θεωρείται δεδομένο ότι αυτά που ζητούνται μπορούν να πραγματοποιηθούν σε κάθε περίπτωση επιλογής υβριδοποιημένων μορίων. 

- Τι θα έπρεπε και τι θα μπορούσε να κάνει ένας μαθητής στο τελευταίο τέταρτο ή στο τελευταίο μισάωρο (μάλλον αδύνατο) που είχε διαθέσιμο; Το πιθανότερο είναι να ψάξει να δει τι δεν κάνει σωστά και δεν βγαίνει η άσκηση και όχι να καταλήξει στο συμπέρασμα ότι του θέμα που του δίνεται με τα αρχικά του δεδομένα δεν λύνεται, και να αιτιολογήσει μάλιστα γιατί δεν λύνεται, πιθανότητα που δεν την επέτρεπε ή δεν την άφηνε καν ανοιχτή η διατύπωση της άσκησης;

- Ή, μήπως, να γυρίσει πίσω να αλλάξει την επιλογή του στο Δ1, όταν εκεί δεν είχε μπει κανένας σχετικός περιορισμός; Παράλογα, αδύνατα πράγματα.

Επειδή:

- μια αδικία είναι εξίσου αδικία είτε αφορά πολλούς, είτε λίγους, είτε ακόμη και έναν

- γίνεται βαρύτερη όταν το λάθος στη διατύπωση χρεώνεται εμμέσως σ’ αυτόν που δεν έχει καμία ευθύνη και είναι ο αδύνατος, στην περίπτωσή μας στον υποψήφιο

- Μεγεθύνεται από το γεγονός ότι το Δ4 βαθμολογείται με πολλά μόρια (12) και η Βιολογία είμαι μάθημα κατεύθυνσης με τον μεγαλύτερο συντελεστή για κάποια τμήματα, άρα μια άδικη βαθμολόγηση μπορεί να έχει δραματικές επιπτώσεις στις πιθανότητες επιτυχίας ενός υποψηφίου.

Πρέπει άμεσα:

- Το Δ4, στην περίπτωση που από την επιλογή των πρώτων μορίων σωστά δεν επιλύεται, να μην βαθμολογηθεί καθόλου και τα αντίστοιχα μόρια να κατανεμηθούν σύμφωνα με τη γενική εικόνα του γραπτού σε όλα τα υπόλοιπα θέματα.

- Η Κεντρική Εξεταστική Επιτροπή να πάρει άμεσα θέση και να ενημερώσει όλα τα εξεταστικά κέντρα για το εν λόγω πρόβλημα. Ένα τόσο σημαντικό λάθος δεν μπορεί να επαφίεται σε μια δεύτερη «τύχη», του πως θα το διαχειριστεί ο διορθωτής.

Κάθε άλλη λύση είναι μια άδικη λύση. Και εδώ δεν έχει νόημα το πολύ ή λίγο.

Δεν υπάρχουν σχόλια:

Δημοσίευση σχολίου

Παρακαλούμε τα σχόλια να είναι αντίστοιχα της ανάρτησης και να μην θίγουν την προσωπικότητα κανενός πολίτη.
Ευχαριστώ για τη Συμμετοχή